Mature sequence hsa-miR-6724-5p

Accession numberMIMAT0025856
IDhsa-miR-6724-5p
Stem-Loop hsa-mir-6724-1 hsa-mir-6724-2 hsa-mir-6724-3 hsa-mir-6724-4
Sequence
cugggcccgcggcgggcgugggg
Get sequence
Deep sequencing4788 reads, 126 experiments

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).