Mature sequence hsa-miR-6722-3p

Accession numberMIMAT0025854
IDhsa-miR-6722-3p
Stem-Loop hsa-mir-6722
Sequence
ugcaggggucgggugggccagg
Get sequence
Deep sequencing11 reads, 7 experiments
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).