Mature sequence bta-miR-503-5p

Accession numberMIMAT0025557
IDbta-miR-503-5p
Stem-Loop bta-mir-503
Sequence
uagcagcgggaacaguacug
Get sequence
Deep sequencing13552 reads, 32 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).