Mature sequence bta-miR-6525

Accession numberMIMAT0025554
IDbta-miR-6525
Stem-Loop bta-mir-6525
Sequence
cuggggaaagcaggagugag
Get sequence
Deep sequencing45 reads, 32 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).