Mature sequence bta-miR-378c

Accession numberMIMAT0025551
IDbta-miR-378c
Stem-Loop bta-mir-378c
Sequence
acuggacuuggagucagaagu
Get sequence
Deep sequencing599159 reads, 78 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).