Mature sequence bta-miR-3956

Accession numberMIMAT0025544
IDbta-miR-3956
Stem-Loop bta-mir-3956
Sequence
acguggaugcugaaggucagagg
Get sequence
Deep sequencing109 reads, 38 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).