Mature sequence hsa-miR-6512-5p

Accession numberMIMAT0025480
IDhsa-miR-6512-5p
Stem-Loop hsa-mir-6512
Sequence
uaccauuagaagagcuggaaga
Get sequence
Deep sequencing56 reads, 24 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).