Mature sequence hsa-miR-548ay-5p

Accession numberMIMAT0025452
IDhsa-miR-548ay-5p
Stem-Loop hsa-mir-548ay
Sequence
aaaaguaauugugguuuuugc
Get sequence
Deep sequencing12156 reads, 154 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).