Mature sequence ssc-miR-582-3p

Accession numberMIMAT0025380
IDssc-miR-582-3p
Stem-Loop ssc-mir-582
Sequence
uaaccgguugaacaacugaacc
Get sequence
Deep sequencing92 reads, 13 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).