Mature sequence ssc-miR-452

Accession numberMIMAT0025374
IDssc-miR-452
Stem-Loop ssc-mir-452
Sequence
aacuguuugcagaggaaacuga
Get sequence
Deep sequencing283 reads, 13 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).