Mature sequence ssc-miR-132

Accession numberMIMAT0025361
IDssc-miR-132
Stem-Loop ssc-mir-132
Sequence
uaacagucuacagccauggucg
Get sequence
Deep sequencing141 reads, 15 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).