Mature sequence ptc-miR6462d

Accession numberMIMAT0025224
IDptc-miR6462d
Stem-Loop ptc-MIR6462d
Sequence
ucucuuaugcauuuuuguccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2