Mature sequence mmu-miR-21c

Accession numberMIMAT0025148
IDmmu-miR-21c
Stem-Loop mmu-mir-21c
Sequence
uagcuuaucagacugguacaa
Get sequence
Deep sequencing3033754 reads, 105 experiments
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).