Mature sequence mmu-miR-378c

Accession numberMIMAT0025138
IDmmu-miR-378c
Stem-Loop mmu-mir-378c
Sequence
acuggacuuggagucagaagc
Get sequence
Deep sequencing12226653 reads, 107 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).