Mature sequence rno-miR-6333

• Accession number: MIMAT0025074
• ID: rno-miR-6333
• Stem-Loop: rno-mir-6333
• Sequence: uaggcuggacuugaacagcccgc
• Deep sequencing: 23 reads, 20 experiments
• Predicted targets:
  • TargetScanVert:rno-miR-6333
  • miRDB:rno-miR-6333

References

1. PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2. PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).