Mature sequence rno-miR-6315

• Accession number: MIMAT0025050
• ID: rno-miR-6315
• Stem-Loop: rno-mir-6315
• Sequence: ucuggacaggacaggcccugagc
• Deep sequencing: 1942 reads, 331 experiments
• Predicted targets:
  • TargetScanVert:rno-miR-6315
  • miRDB:rno-miR-6315

References

1. PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2. PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).