Mature sequence gma-miR390e

Accession numberMIMAT0024907
IDgma-miR390e
Stem-Loop gma-MIR390e
Sequence
agcucaggagggauagcgcc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).