Mature sequence hsa-miR-6081

Accession numberMIMAT0023706
IDhsa-miR-6081
Stem-Loop hsa-mir-6081
Sequence
aggagcagugccggccaaggcgcc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).