Mature sequence hsa-miR-6077

Accession numberMIMAT0023702
IDhsa-miR-6077
Stem-Loop hsa-mir-6077
Sequence
gggaagagcuguacggccuuc
Get sequence
Deep sequencing7 reads, 7 experiments
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).