Mature sequence hsa-miR-6076

Accession numberMIMAT0023701
IDhsa-miR-6076
Stem-Loop hsa-mir-6076
Sequence
agcaugacagaggagaggugg
Get sequence
Deep sequencing9 reads, 7 experiments
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).