Mature sequence hsa-miR-6072

Accession numberMIMAT0023697
IDhsa-miR-6072
Stem-Loop hsa-mir-6072
Sequence
uccucaucacacugcaccuuag
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).