Mature sequence ame-miR-6001-3p

Accession numberMIMAT0023542
IDame-miR-6001-3p
Stem-Loop ame-mir-6001
Sequence
uucucuuugguuguuaccacua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).