Mature sequence osa-miR812t

Accession numberMIMAT0023272
IDosa-miR812t
Stem-Loop osa-MIR812t
Sequence
acggaaaaucauggcugcacuuaa
Get sequence
Deep sequencing888 reads, 2 experiments

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).