Mature sequence gma-miR399f

Accession numberMIMAT0023241
IDgma-miR399f
Stem-Loop gma-MIR399f
Sequence
ugccaaaggagauuugcccag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).