Mature sequence hsa-miR-216a-3p

Accession numberMIMAT0022844
IDhsa-miR-216a-3p
Stem-Loop hsa-mir-216a
Sequence
ucacaguggucucugggauuau
Get sequence
Deep sequencing6729 reads, 31 experiments
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).