Mature sequence hsa-miR-3190-3p

Accession numberMIMAT0022839
IDhsa-miR-3190-3p
Stem-Loop hsa-mir-3190
Sequence
uguggaagguagacggccagaga
Get sequence
Deep sequencing762 reads, 63 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).