Mature sequence hsa-miR-1307-5p

Accession numberMIMAT0022727
IDhsa-miR-1307-5p
Stem-Loop hsa-mir-1307
Sequence
ucgaccggaccucgaccggcu
Get sequence
Deep sequencing66535 reads, 155 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).