Mature sequence hsa-miR-1255b-2-3p

Accession numberMIMAT0022725
IDhsa-miR-1255b-2-3p
Stem-Loop hsa-mir-1255b-2
Sequence
aaccacuuucuuugcucaucca
Get sequence
Deep sequencing20 reads, 13 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).