Mature sequence hsa-miR-1277-5p

Accession numberMIMAT0022724
IDhsa-miR-1277-5p
Stem-Loop hsa-mir-1277
Sequence
aaauauauauauauauguacguau
Get sequence
Deep sequencing10737 reads, 142 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).