Mature sequence hsa-miR-659-5p

Accession numberMIMAT0022710
IDhsa-miR-659-5p
Stem-Loop hsa-mir-659
Sequence
aggaccuucccugaaccaagga
Get sequence
Deep sequencing872 reads, 92 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).