Mature hsa-miR-181b-3p
| Accession | MIMAT0022692 |
| Description | hsa-miR-181b-3p mature miRNA |
| Hairpins | |
| Sequence | CUCACUGAACAAUGAAUGCAA |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18728182 | has_input UniProtKB:Q92831 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18728182 | has_input UniProtKB:Q92831 |
| involved_in | GO:0045429 positive regulation of nitric oxide biosynthetic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22232059 | |
| involved_in | GO:0045603 positive regulation of endothelial cell differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22232059 | |
| involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22232059 |
