Mature sequence mmu-miR-5709-5p

Accession numberMIMAT0022504
IDmmu-miR-5709-5p
Stem-Loop mmu-mir-5709
Sequence
auacgcacacuuaagacuuuag
Get sequence
Deep sequencing189 reads, 24 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21984899 "Neuronal activity regulates hippocampal miRNA expression" Eacker SM, Keuss MJ, Berezikov E, Dawson VL, Dawson TM PLoS One. 6:e25068(2011).