Mature sequence hsa-miR-4666b

Accession numberMIMAT0022485
IDhsa-miR-4666b
Stem-Loop hsa-mir-4666b
Sequence
uugcaugucagauuguaauuccc
Get sequence
Deep sequencing3 reads, 2 experiments
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).