Mature sequence mtr-miR2111a-3p

Accession numberMIMAT0022240
IDmtr-miR2111a-3p
Previous IDsmtr-miR2111v*
Stem-Loop mtr-MIR2111a
Sequence
agccuuggaaugcagauuauc
Get sequence
Deep sequencing reads, experiments

References

1