Mature sequence mtr-miR2111a-5p

Accession numberMIMAT0022239
IDmtr-miR2111a-5p
Previous IDsmtr-miR2111v
Stem-Loop mtr-MIR2111a
Sequence
uaaucugcauccugagguuua
Get sequence
Deep sequencing reads, experiments

References

1