Mature sequence mtr-miR167b-5p

Accession numberMIMAT0022233
IDmtr-miR167b-5p
Previous IDsmtr-miR167b
Stem-Loop mtr-MIR167b
Sequence
ugaagcugccagcaugaucug
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).