Mature sequence mtr-miR2592bl-5p

Accession numberMIMAT0022205
IDmtr-miR2592bl-5p
Previous IDsmtr-miR2592bl
Stem-Loop mtr-MIR2592bl
Sequence
uggcaaguuugaauuuaccuca
Get sequence
Deep sequencing reads, experiments

References

1