Mature sequence osa-miR5514

Accession numberMIMAT0022148
IDosa-miR5514
Stem-Loop osa-MIR5514
Sequence
ucccagagcuuuggccgucgc
Get sequence
Deep sequencing reads, experiments

References

1