Mature sequence sbi-miR5388

Accession numberMIMAT0021686
IDsbi-miR5388
Stem-Loop sbi-MIR5388
Sequence
aucuuugccgggugucucugac
Get sequence
Deep sequencing reads, experiments

References

1