Mature sequence gma-miR172j

Accession numberMIMAT0021660
IDgma-miR172j
Stem-Loop gma-MIR172j
Sequence
gcagcagcaucaagauucaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).