Mature sequence mtr-miR2592t

Accession numberMIMAT0021149
IDmtr-miR2592t
Stem-Loop mtr-MIR2592t
Sequence
caacaggacucaagcauuucgc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).