Mature sequence hsa-miR-5191

Accession numberMIMAT0021122
IDhsa-miR-5191
Stem-Loop hsa-mir-5191
Sequence
aggauaggaagaaugaagugcu
Get sequence
Deep sequencing53 reads, 11 experiments
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).