Mature sequence hsa-miR-5186

Accession numberMIMAT0021116
IDhsa-miR-5186
Stem-Loop hsa-mir-5186
Sequence
agagauugguagaaaucaggu
Get sequence
Deep sequencing12 reads, 7 experiments
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).