Mature sequence gma-miR1521b

Accession numberMIMAT0021065
IDgma-miR1521b
Stem-Loop gma-MIR1521b
Sequence
gacugucacgugucauaaucaua
Get sequence
Deep sequencing reads, experiments

References

1