Mature sequence gma-miR169h

Accession numberMIMAT0021062
IDgma-miR169h
Stem-Loop gma-MIR169h
Sequence
ggcgagacaucuuggcucauu
Get sequence
Deep sequencing reads, experiments

References

1