Mature sequence gma-miR1516b

Accession numberMIMAT0021061
IDgma-miR1516b
Stem-Loop gma-MIR1516b
Sequence
agcuucucuacagaaaauaua
Get sequence
Deep sequencing reads, experiments

References

1