Mature sequence hsa-miR-5011-5p

Accession numberMIMAT0021045
IDhsa-miR-5011-5p
Stem-Loop hsa-mir-5011
Sequence
uauauauacagccaugcacuc
Get sequence
Deep sequencing3 reads, 3 experiments
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).