Mature sequence gma-miR169g

Accession numberMIMAT0020987
IDgma-miR169g
Stem-Loop gma-MIR169g
Sequence
cagccaaggaugacuugccgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).