Mature sequence gma-miR160d

Accession numberMIMAT0020972
IDgma-miR160d
Stem-Loop gma-MIR160d
Sequence
ugccuggcucccuguaugcc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2