Mature sequence dme-miR-1016-5p

Accession numberMIMAT0020908
IDdme-miR-1016-5p
Stem-Loop dme-mir-1016
Sequence
uaaguauagagaggauguga
Get sequence
Deep sequencing176 reads, 30 experiments
Database links
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).